Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCL4-chemokine (C-C motif) ligand 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL4-chemokine (C-C motif) ligand 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC104226 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL4 |
| Origin species: | Human |
| Product name: | CCL4-chemokine (C-C motif) ligand 4 Gene |
| Size: | 2ug |
| Accessions: | BC104226 |
| Gene id: | 6351 |
| Gene description: | chemokine (C-C motif) ligand 4 |
| Synonyms: | ACT2; AT744.1; G-26; HC21; LAG-1; LAG1; MIP-1-beta; MIP1B; MIP1B1; SCYA2; SCYA4; C-C motif chemokine 4; G-26 T-lymphocyte-secreted protein; MIP-1-beta(1-69); PAT 744; SIS-gamma; T-cell activation protein 2; chemokine (C-C motif) ligand 4; lymphocyte activation gene 1 protein; macrophage inflammatory protein 1-beta; secreted protein G-26; small inducible cytokine A4 (homologous to mouse Mip-1b); C-C motif chemokine ligand 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagctctgcgtgactgtcctgtctctcctcatgctagtagctgccttctgctctccagcgctctcagcaccaatgggctcagaccctcccaccgcctgctgcttttcttacaccgcgaggaagcttcctcgcaactttgtggtagattactatgagaccagcagcctctgctcccagccagctgtggtattccaaaccaaaagaagcaagcaagtctgtgctgatcccagtgagacctgggtccaggagtacgtgtatgacctggaactgaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LY6/PLAUR domain containing 2 - ripply1 homolog (zebrafish) - D-amino acid oxidase activator - slowmo homolog 1 (Drosophila) |