Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DAOA-D-amino acid oxidase activator Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DAOA-D-amino acid oxidase activator Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121091 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DAOA |
| Origin species: | Human |
| Product name: | DAOA-D-amino acid oxidase activator Gene |
| Size: | 2ug |
| Accessions: | BC121091 |
| Gene id: | 267012 |
| Gene description: | D-amino acid oxidase activator |
| Synonyms: | LG72; SG72; D-amino acid oxidase activator; G72 transcript; schizophrenia- and bipolar disorder-associated protein G72 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctggaaaagctgatgggtgctgattctctccagcttttcagatccagatatacattgggtaaaatctacttcataggttttcaaaggagcattcttctgagcaaatctgaaaactctctaaactctattgcaaaggagacagaagaaggaagagagacggtaacaaggaaagaaggatggaagagaaggcatgaggacggctatttggaaatggcacagaggcatttacagagatcattatgtccttgggtctcttaccttcctcagccctatgcagagcttgaagaagtaagcagccatgttggaaaagtcttcatggcaagaaactatgagttccttgcctatgaggcctctaaggaccgcaggcagcctctagaacgaatgtggacctgcaactacaaccagcaaaaagaccagtcatgcaaccacaaggaaataacttctaccaaagctgaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - slowmo homolog 1 (Drosophila) - neuropeptides B/W receptor 1 - G protein-coupled receptor 68 - BCL2-like 12 (proline rich) |