Cart 6 Product Products 2 702,92 € (empty)
-
-
-
1 x Chicken...275,00 € -
-
1 x MAD MOUSE532,92 € -
No products
247,00 € DAP Shipping
2 949,92 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 702,92 €
Total shipping (tax excl.) 247,00 €
Total (tax excl.) 2 949,92 €
Data sheet of RIPPLY1-ripply1 homolog (zebrafish) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RIPPLY1-ripply1 homolog (zebrafish) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC105692 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RIPPLY1 |
| Origin species: | Human |
| Product name: | RIPPLY1-ripply1 homolog (zebrafish) Gene |
| Size: | 2ug |
| Accessions: | BC105692 |
| Gene id: | 92129 |
| Gene description: | ripply1 homolog (zebrafish) |
| Synonyms: | ripply1 homolog; protein ripply1; ripply transcriptional repressor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactctgctgcctgtgctgctgctgccacccctgttccagccctggctttggccctagctccagacctagcacaagccccactggcactccctggcctgttaagcccatcttgccttctctcctctggacaagaagtaaatgggagtgaaagaggaacttgtctctggaggccctggctgtcttccacaaatgactccccaaggcagatgaggaagctggtggatttggctgctggtggggcaacggctgctgaggtcaccaaggctgaatccaagttccatcaccctgtcaggctcttctggcctaaatcccgctccttcgactatctgtacagtgctggggagattttactgcagaactttcctgtccaggcaaccatcaacctatacgaggactcagacagcgaagaagaagaggaagatgaagagcaggaggatgaagaagagaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - D-amino acid oxidase activator - slowmo homolog 1 (Drosophila) - neuropeptides B/W receptor 1 - G protein-coupled receptor 68 |