Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KIR2DS2-killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 Gene
PTXBC108917
New product
Data sheet of KIR2DS2-killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIR2DS2-killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC108917 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIR2DS2 |
| Origin species: | Human |
| Product name: | KIR2DS2-killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 Gene |
| Size: | 2ug |
| Accessions: | BC108917 |
| Gene id: | 100132285 |
| Gene description: | killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 |
| Synonyms: | killer cell immunoglobulin-like receptor KIR2DS2; 183ActI; CD158J; CD158b; KIR-2DS2; NKAT-5; NKAT5; cl-49; killer cell immunoglobulin-like receptor 2DS2; CD158 antigen-like family member J; MHC class I NK cell receptor; NK receptor 183 ActI; killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2; killer-cell Ig-like receptor; killer-cell immunoglobulin-like receptor two domains short tail 2 protein; natural killer associated transcript 5; natural killer cell inhibitory receptor; p58 killer cell inhibitory receptor KIR-K7a; p58 natural killer cell receptor clone CL-49; killer cell immunoglobulin like receptor, two Ig domains and short cytoplasmic tail 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgctcactgtcgtcagcatggcgtgtgttgggttcttcttgctgcagggggcctggccacatgagggagtccacagaaaaccttccctcctggcccacccaggtcccctggtgaaatcagaagagacagtcatcctgcaatgttggtcagatgtcaggtttgagcacttccttctgcacagagaggggaagtataaggacactttgcacctcattggagagcaccatgatggggtctccaaggccaacttctccatcggtcccatgatgcaagaccttgcagggacctacagatgctacggttctgttactcactccccctatcagttgtcagctcccagtgaccctctggacatcgtcatcacaggtctatatgagaaaccttctctctcagcccagccgggccccacggttttggcaggagagagcgtgaccttgtcctgcagctcccggagctcctatgacatgtaccatctatccagggagggggaggcccatgaacgtaggttctctgcagggcccaaggtcaacggaacattccaggccgactttcctctgggccctgccacccacggaggaacctacagatgcttcggctctttccgtgactctccctatgagtggtcaaactcgagtgacccactgcttgtttctgtcacaggaaacccttcaaatagttggccttcacccactgaaccaagctccaaaaccggtaaccccagacacctgcatgttctgattgggacctcagtggtcaaaatccctttcaccatcctcctcttctttctccttcatcgctggtgctccaacaaaaaaaatgctgctgtaatggaccaagagcctgcagggaacagaacagtgaacagcgagagagaaatcactcgcccttctgagaggcccaagacacccccaacagataccagcatgtacatagaacttccaaatgctgagcccagatccaaagttgtcttctgtccacgagcaccacagtcaggccttgaggggatcttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 - NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase) - solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2 - glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 |