Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KIR2DS4-killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 Gene
PTXBC096694
New product
Data sheet of KIR2DS4-killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIR2DS4-killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096694 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIR2DS4 |
| Origin species: | Human |
| Product name: | KIR2DS4-killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 Gene |
| Size: | 2ug |
| Accessions: | BC096694 |
| Gene id: | 3809 |
| Gene description: | killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 |
| Synonyms: | CD158I; KIR-2DS4; KIR1D; KIR412; KKA3; NKAT-8; NKAT8; killer cell immunoglobulin-like receptor 2DS4; CD158 antigen-like family member I; KIR antigen 2DS4; P58 natural killer cell receptor clones CL-39/CL-17; killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4; killer inhibitory receptor 4-1-2; natural killer-associated transcript 8; p50 killer cell activating receptor KAR-K1d; p58 NK receptor CL-39/CL-17; killer cell immunoglobulin like receptor, two Ig domains and short cytoplasmic tail 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgctcatggtcatcatcatggcgtgtgttgggttcttcttgctgcagggggcctggccacaggagggagtccacagaaaaccttccttcctggccctcccaggtcacctggtgaaatcagaagagacagtcatcctgcaatgttggtcggatgtcatgtttgagcacttccttctgcacagagaggggaagtttaacaacactttgcacctcattggagagcaccatgatggggtttccaaggccaacttctccattggtcccatgatgcctgtccttgcaggaacctacagatgctacggttctgttcctcactccccctatcagttgtcagctcccagtgaccctctggacatggtgatcataggtctatatgagaaaccttctctctcagcccagccgggccccacggttcaggcaggagagaatgtgaccttgtcctgcagctcccggagctcctatgacatgtaccatctatccagggaaggggaggcccatgaacgtaggctccctgcagtgcgcagcatcaacggaacattccaggccgactttcctctgggccctgccacccacggagggacctacagatgcttcggctctttccgtgacgctccctacgagtggtcaaactcgagtgatccactgcttgtttccgtcacaggaaacccttcaaatagttggccttcacccactgaaccaagctccaaaaccggtaaccccagacacctacatgttctgattgggacctcagtggtcaaaatccctttcaccatcctcctcttctttctccttcatcgctggtgctccgacaaaaaaaatgctgctgtaatggaccaagagcctgcagggaacagaacagtgaacagcgaggattctgatgaacaagaccatcaggaggtgtcatacgcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase) - solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2 - glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 - aldo-keto reductase family 1, member A1 (aldehyde reductase) |