Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of INSL3-insulin-like 3 (Leydig cell) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about INSL3-insulin-like 3 (Leydig cell) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC106722 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | INSL3 |
| Origin species: | Human |
| Product name: | INSL3-insulin-like 3 (Leydig cell) Gene |
| Size: | 2ug |
| Accessions: | BC106722 |
| Gene id: | 3640 |
| Gene description: | insulin-like 3 (Leydig cell) |
| Synonyms: | prepro-INSL3; RLF; RLNL; ley-I-L; insulin-like 3; insulin-like 3 (Leydig cell); leydig insulin -like hormone; leydig insulin-like peptide; relaxin-like factor b; insulin like 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacccccgtctgcccgcctgggcgctggtgctgctgggccctgccctggtgttcgcgttgggccccgcgcccaccccagagatgcgtgagaagttgtgcggccaccacttcgtacgcgcgctagtgcgcgtgtgcgggggcccccgctggtccaccgaagccaggaggcctgcgaccggaggcgaccgtgagttgctacagtggctggagagacgacatctgctccatgggctggtggccgacagtaatctcacgctgggacctggcctgcagcccctgccccagacctctcaccatcaccgccaccaccgtgcagctgccaccaaccctgcacgctactgctgcctcagtggctgtacccaacaagacctgctgaccctctgtccctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Yip1 domain family, member 7 - variable charge, X-linked 3A - sperm acrosome associated 3 - B and T lymphocyte associated |