Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SPACA3-sperm acrosome associated 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPACA3-sperm acrosome associated 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC100887 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPACA3 |
| Origin species: | Human |
| Product name: | SPACA3-sperm acrosome associated 3 Gene |
| Size: | 2ug |
| Accessions: | BC100887 |
| Gene id: | 124912 |
| Gene description: | sperm acrosome associated 3 |
| Synonyms: | ALLP17; CT54; LYC3; LYZC; LYZL3; SLLP1; sperm acrosome membrane-associated protein 3; cancer/testis antigen 54; lysozyme C; lysozyme-like acrosomal sperm-specific secretory protein ALLP-17; lysozyme-like protein 3; lysozyme-like sperm-specific secretory protein ALLP17; sperm lysozyme-like protein 1; sperm lyzozyme-like acrosomal protein 1; sperm protein reactive with ASA; sperm protein reactive with antisperm antibodies; sperm acrosome associated 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtctcagctctgcggggagcacccctgatcagggtgcactcaagccctgtttcttctccttctgtgagtggaccacggaggctggtgagctgcctgtcatcccaaagctcagctctgagccagagtggtggtggctccacctctgccgccggcatagaagccaggagcagggctctcagaaggcggtggtgcccagctgggatcatgttgttggccctggtctgtctgctcagctgcctgctaccctccagtgaggccaagctctacggtcgttgtgaactggccagagtgctacatgacttcgggctggacggataccggggatacagcctggctgactgggtctgccttgcttatttcacaagcggtttcaacgcagctgctttggactacgaggctgatgggagcaccaacaacgggatcttccagatcaacagccggaggtggtgcagcaacctcaccccgaacgtccccaacgtgtgccggatgtactgctcagatttgttgaatcctaatctcaaggataccgttatctgtgccatgaagataacccaagagcctcagggtctgggttactgggaggcctggaggcatcactgccagggaaaagacctcactgaatgggtggatggctgtgacttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - B and T lymphocyte associated - fructose-1,6-bisphosphatase 2 - sulfatase modifying factor 1 - mex-3 homolog D (C. elegans) |