Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of YIPF7-Yip1 domain family, member 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about YIPF7-Yip1 domain family, member 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC103996 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | YIPF7 |
| Origin species: | Human |
| Product name: | YIPF7-Yip1 domain family, member 7 Gene |
| Size: | 2ug |
| Accessions: | BC103996 |
| Gene id: | 285525 |
| Gene description: | Yip1 domain family, member 7 |
| Synonyms: | protein YIPF7; FinGER9; YIP1 family member 7; five-pass transmembrane protein localizing in the Golgi apparatus and the endoplasmic reticulum 9; Yip1 domain family member 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatttgcttaaaatttctcacacaaagctacatttactggaggatctttctataaaaaataaacagaggatgtcaaacttggcacaatttgactctgatttttaccaatctaattttactattgataaccaggagcagagtggtaatgactctaatgcctatggaaatctttatggatctagaaaacaacaagctggtgagcagcctcagcctgcctcctttgttccatcagagatgctcatgtcatcgggttacgcaggacaattttttcagccagcatccaactcagattattattcacaatctccttacattgacagttttgatgaagagcctcctttgctagaagataagaacttggaatccattttgatcacatatggcaaaaaactttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - variable charge, X-linked 3A - sperm acrosome associated 3 - B and T lymphocyte associated - fructose-1,6-bisphosphatase 2 |