YPEL3-yippee-like 3 (Drosophila) Gene View larger

YPEL3-yippee-like 3 (Drosophila) Gene

PTXBC005009

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of YPEL3-yippee-like 3 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about YPEL3-yippee-like 3 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005009
Product type: DNA & cDNA
Ncbi symbol: YPEL3
Origin species: Human
Product name: YPEL3-yippee-like 3 (Drosophila) Gene
Size: 2ug
Accessions: BC005009
Gene id: 83719
Gene description: yippee-like 3 (Drosophila)
Synonyms: protein yippee-like 3; yippee like 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcggatttcaaagcccaagacgtttcaggcctacttggatgattgtcaccggaggtatagctgtgcccactgccgcgctcacctggccaaccacgacgacctcatctccaagtccttccagggcagtcaggggcgtgcctacctcttcaactcagtggtgaacgtgggctgcgggccagccgaggagcgggtgctgctgaccggcctccatgctgtcgccgacatccactgcgagaactgcaagaccactttgggctggaaatatgaacaggcctttgagagcagccagaagtacaaagaggggaagtacatcattgaactcaaccacatgatcaaagacaacggctgggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical LOC284297
- yippee-like 2 (Drosophila)
- late cornified envelope 3C
- late cornified envelope 2D

Reviews

Buy YPEL3-yippee-like 3 (Drosophila) Gene now

Add to cart