Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of LCE2D-late cornified envelope 2D Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LCE2D-late cornified envelope 2D Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130603 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LCE2D |
| Origin species: | Human |
| Product name: | LCE2D-late cornified envelope 2D Gene |
| Size: | 2ug |
| Accessions: | BC130603 |
| Gene id: | 353141 |
| Gene description: | late cornified envelope 2D |
| Synonyms: | LEP12; SPRL1A; late cornified envelope protein 2D; late envelope protein 12; small proline rich-like (epidermal differentiation complex) 1A; small proline-rich-like epidermal differentiation complex protein 1A; late cornified envelope 2D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcttgccagcaaaaccagcagcagtgccagccccctcccaaatgtcctcccaagtgtaccccaaaatgtccacctaagtgtccccccaaatgcccaccacagtgcccagctccatgttcccctgcagtctcttcctgctgtggtcccagctctgggagctgctgtggtcccagctctgggggctgctgcagctctgggggtggtggctgctgcctgagccaccacaggccccgtctcttccaccggcgccggcaccagagccccgattgctgtgagagtgaaccttctggggcctctggctgctgccacagctctgggggctgctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical LOC153684 - hypothetical LOC149134 - hypothetical LOC339535 - hypothetical LOC440337 |