Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of LCE3C-late cornified envelope 3C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LCE3C-late cornified envelope 3C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130365 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LCE3C |
| Origin species: | Human |
| Product name: | LCE3C-late cornified envelope 3C Gene |
| Size: | 2ug |
| Accessions: | BC130365 |
| Gene id: | 353144 |
| Gene description: | late cornified envelope 3C |
| Synonyms: | LEP15; SPRL3A; late cornified envelope protein 3C; late envelope protein 15; small proline rich-like (epidermal differentiation complex) 3A; small proline-rich-like epidermal differentiation complex protein 3A; late cornified envelope 3C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcctgccagcaaaaccagcagcagtgccagccccctcccagttgtccctcacccaagtgtcccccaaagagcccagcacagtgtctgcctccaccctcttctgactgtgctctaagctccgggggctgtggccccagttctgaaagtggctgctgcctgagccaccacaggcacttcaggtcccatcaatgccggcgccagagatccaactcctgtgacaggggcagtggtcagcaaggcgggggctcctgccgtggccatggctctgggggctgctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - late cornified envelope 2D - hypothetical LOC153684 - hypothetical LOC149134 - hypothetical LOC339535 |