Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLR2H-polymerase (RNA) II (DNA directed) polypeptide H Gene
PTXBC000739
New product
Data sheet of POLR2H-polymerase (RNA) II (DNA directed) polypeptide H Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLR2H-polymerase (RNA) II (DNA directed) polypeptide H Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000739 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR2H |
| Origin species: | Human |
| Product name: | POLR2H-polymerase (RNA) II (DNA directed) polypeptide H Gene |
| Size: | 2ug |
| Accessions: | BC000739 |
| Gene id: | 5437 |
| Gene description: | polymerase (RNA) II (DNA directed) polypeptide H |
| Synonyms: | RPABC3; RPB17; RPB8; DNA-directed RNA polymerases I, II, and III subunit RPABC3; DNA-directed RNA polymerase II subunit H; DNA-directed RNA polymerases I, II, and III 17.1 kDa polypeptide; RPB8 homolog; polymerase (RNA) II (DNA directed) polypeptide H; polymerase (RNA) II subunit H; RNA polymerase II subunit H |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgggcatcctgtttgaggatattttcgatgtgaaggatattgacccggagggcaagaagtttgaccgagtgtctcgactgcattgtgagagtgaatctttcaagatggatctaatcttagatgtaaacattcaaatttaccctgtagacttgggtgacaagtttcggttggtcatagctagtaccttgtatgaagatggtaccctggatgatggtgaatacaaccccactgatgataggccttccagggctgaccagtttgagtatgtaatgtatggaaaagtgtacaggattgagggagatgaaacttctactgaagcagcaacacgcctctctgcgtacgtgtcctatgggggcctgctcatgaggctgcagggggatgccaacaacctgcatggattcgaggtggactccagagtttatctcctgatgaagaagctagccttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitogen-activated protein kinase kinase kinase 7 - cell division cycle 20 homolog B (S. cerevisiae) - stress-associated endoplasmic reticulum protein 1 - vitelline membrane outer layer 1 homolog (chicken) |