Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CDC20B-cell division cycle 20 homolog B (S. cerevisiae) Gene
PTXBC037547
New product
Data sheet of CDC20B-cell division cycle 20 homolog B (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDC20B-cell division cycle 20 homolog B (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC037547 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDC20B |
| Origin species: | Human |
| Product name: | CDC20B-cell division cycle 20 homolog B (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC037547 |
| Gene id: | 166979 |
| Gene description: | cell division cycle 20 homolog B (S. cerevisiae) |
| Synonyms: | G6VTS76519; cell division cycle protein 20 homolog B; CDC20 cell division cycle 20 homolog B; CDC20-like protein; cell division cycle 20 homolog B; cell division cycle 20B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtggaaactggagcgcaccgcgcctcggagggtccgcacggaagaggagatgctgtgggtactcgattcagttaatgctacgtattctgactttaagagcaactttgcgaagaggctgtccgcagaggttcctgttgcgagtagccccattaccacaaggtggcagcaaagtcaaactagggctctgtcctctgattcctttggggaagagcagtcaaccacctacctcccagaagcttccggatcagtgctgaagacaccgcctgagaaagagaccttgactctaggatcctgcaaagaacaactgaagacccccagcaaaggaatttctgaaacaagtaactctgctctccatttttgcaaggcacctcatgcaatggacagagactggaaagaaagtgttgcctcaaaagggcagaaatgcctaaaacaactctttgtaacccagaacgtggttcagcaggctaatggaaaaatgcagctctgtgagcaatccgaatgtgtttggaaagatcactttagtggcagcatgaagaaacgatttgaacaggaggatgttggtggcaaagactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - stress-associated endoplasmic reticulum protein 1 - vitelline membrane outer layer 1 homolog (chicken) - C1q and tumor necrosis factor related protein 3 - terminal uridylyl transferase 1, U6 snRNA-specific |