Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VMO1-vitelline membrane outer layer 1 homolog (chicken) Gene
PTXBC104195
New product
Data sheet of VMO1-vitelline membrane outer layer 1 homolog (chicken) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VMO1-vitelline membrane outer layer 1 homolog (chicken) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC104195 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VMO1 |
| Origin species: | Human |
| Product name: | VMO1-vitelline membrane outer layer 1 homolog (chicken) Gene |
| Size: | 2ug |
| Accessions: | BC104195 |
| Gene id: | 284013 |
| Gene description: | vitelline membrane outer layer 1 homolog (chicken) |
| Synonyms: | ERGA6350; PRO21055; vitelline membrane outer layer protein 1 homolog; vitelline membrane outer layer 1 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcggggcgcaggagccaagctgctgccgctgctgctgcttctgcgggcgactggtttcacatgtgcacagacagatggccggaacggctacacggcggtcatcgaagtgaccagcgggggtccctggggcgactgggcctggcctgagatgtgtcccgatggattcttcgccagcgggttctcgctcaaggtggagcctccccaaggcattcctggcgacgacactgcactgaatgggatcaggctgcactgcgcgcgcgggaacgtcctaggcaatacgcacgtggtagagtcccagtctggaagctggggcgaatggagtgagccgctgtggtgtcgcggcggcgcctacctagtggctttctcgcttcgcgtggaggcacccacgaccctcggtgacaacacagcagcgaacaacgtgcgcttccgctgttcagacggcgaggaactgcaggggcctgggctgagctggggagactttggagactggagtgaccattgccccaagggcgcgtgcggcctgcagaccaagatccagggacctagaggcctcggcgatgacactgcgctgaacgacgcgcgcttattctgctgccgcagttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - C1q and tumor necrosis factor related protein 3 - terminal uridylyl transferase 1, U6 snRNA-specific - URB2 ribosome biogenesis 2 homolog (S. cerevisiae) - connector enhancer of kinase suppressor of Ras 2 |