MAGOH-mago-nashi homolog, proliferation-associated (Drosophila) Gene View larger

MAGOH-mago-nashi homolog, proliferation-associated (Drosophila) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAGOH-mago-nashi homolog, proliferation-associated (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAGOH-mago-nashi homolog, proliferation-associated (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018211
Product type: DNA & cDNA
Ncbi symbol: MAGOH
Origin species: Human
Product name: MAGOH-mago-nashi homolog, proliferation-associated (Drosophila) Gene
Size: 2ug
Accessions: BC018211
Gene id: 4116
Gene description: mago-nashi homolog, proliferation-associated (Drosophila)
Synonyms: MAGOH1; MAGOHA; protein mago nashi homolog; mago-nashi homolog, proliferation-associated; mago homolog, exon junction complex core component
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagtgacttttatctgcgttactacgtggggcacaagggcaagttcggccacgagttcctggagtttgagtttcgaccggacgggaagttaagatatgccaacaacagcaattacaagaatgatgtcatgatcagaaaagaggcttatgtacataaaagcgtgatggaggaactgaagagaataattgacgacagtgaaattaccaaagaggatgatgcattgtggcctcctcctgaccgagtgggccggcaggagcttgaaatcgtcattggagatgaacacatttcttttacaacatcaaaaattggttcccttattgatgtcaatcaatccaaggatccagaaggcttacgagtattttattatcttgtccaggacctgaagtgtttggtcttcagtcttattggattacacttcaagattaaaccaatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
- protein kinase (cAMP-dependent, catalytic) inhibitor gamma
- glycosylphosphatidylinositol anchored molecule like protein
- biogenesis of lysosomal organelles complex-1, subunit 1

Buy MAGOH-mago-nashi homolog, proliferation-associated (Drosophila) Gene now

Add to cart