Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
BLOC1S1-biogenesis of lysosomal organelles complex-1, subunit 1 Gene
PTXBC130640
New product
Data sheet of BLOC1S1-biogenesis of lysosomal organelles complex-1, subunit 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BLOC1S1-biogenesis of lysosomal organelles complex-1, subunit 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130640 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BLOC1S1 |
| Origin species: | Human |
| Product name: | BLOC1S1-biogenesis of lysosomal organelles complex-1, subunit 1 Gene |
| Size: | 2ug |
| Accessions: | BC130640 |
| Gene id: | 2647 |
| Gene description: | biogenesis of lysosomal organelles complex-1, subunit 1 |
| Synonyms: | BLOS1; BORCS1; GCN5L1; MICoA; RT14; biogenesis of lysosome-related organelles complex 1 subunit 1; BLOC subunit 1; BLOC-1 subunit 1; GCN5 (general control of amino-acid synthesis, yeast, homolog)-like 1; GCN5 general control of amino-acid synthesis 5-like 1; GCN5-like protein 1; MTA1-interacting coactivator; biogenesis of lysosomal organelles complex 1 subunit 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgtcccgcctcctaaaagaacaccaggccaagcagaatgaacgcaaggagctgcaggaaaagaggaggcgagaggctatcactgcagcgacctgcctgacagaagctttggtggatcacctcaatgtgggtgtggcccaggcctacatgaaccagagaaagctggaccatgaggtgaagaccctacaggtccaggctgcccaatttgccaagcagacaggccagtggatcggaatggtggagaacttcaaccaggcactcaaggaaattggggatgtggagaactgggctcggagcatcgagctggacatgcgcaccattgccactgcactggaatatgtctacaaagggcagctgcagtctgccccttcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CCR4 carbon catabolite repression 4-like (S. cerevisiae) - angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 - N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3 - solute carrier family 39 (zinc transporter), member 10 |