Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GML-glycosylphosphatidylinositol anchored molecule like protein Gene
PTXBC126336
New product
Data sheet of GML-glycosylphosphatidylinositol anchored molecule like protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GML-glycosylphosphatidylinositol anchored molecule like protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC126336 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GML |
| Origin species: | Human |
| Product name: | GML-glycosylphosphatidylinositol anchored molecule like protein Gene |
| Size: | 2ug |
| Accessions: | BC126336 |
| Gene id: | 2765 |
| Gene description: | glycosylphosphatidylinositol anchored molecule like protein |
| Synonyms: | LY6DL; glycosyl-phosphatidylinositol-anchored molecule-like protein; GPI anchored molecule like protein; Glycosylphosphatidylinositol-anchored molecule-like protein; glycosylphosphatidylinositol anchored molecule like protein; glycosylphosphatidylinositol anchored molecule like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcctctttgccttactcctagccatggagctcccattggtggcagccagtgccaccatgcgcgctcagtggacttacagtttgagatgccatgactgtgcggtcataaatgacttcaactgtcccaacattagagtatgtccgtatcatattaggcgctgtatgacaatctccattcgcataaattctcgtgaactacttgtttataagaactgtacaaacaactgcacatttgtatatgcagctgaacagcctcctgaagccccaggaaaaatcttcaaaactaatagcttctactgggtttgttgttgtaatagcatggtttgcaatgcaggaggacctactaatcttgaaagggacatgttacccgatgaagtaactgaggaggagcttccagaaggaactgtgaggctgggggtatcaaaactgttgctgagttttgcctctatcatagtcagcaatatattgccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - biogenesis of lysosomal organelles complex-1, subunit 1 - CCR4 carbon catabolite repression 4-like (S. cerevisiae) - angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 - N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3 |