Login to display prices
Login to display prices
FASLG-Fas ligand (TNF superfamily, member 6) Gene View larger

FASLG-Fas ligand (TNF superfamily, member 6) Gene

PTXBC017502

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FASLG-Fas ligand (TNF superfamily, member 6) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FASLG-Fas ligand (TNF superfamily, member 6) Gene

Proteogenix catalog: PTXBC017502
Ncbi symbol: FASLG
Product name: FASLG-Fas ligand (TNF superfamily, member 6) Gene
Size: 2ug
Accessions: BC017502
Gene id: 356
Gene description: Fas ligand (TNF superfamily, member 6)
Synonyms: ALPS1B; APT1LG1; APTL; CD178; CD95-L; CD95L; TNFSF6; TNLG1A; tumor necrosis factor ligand superfamily member 6; CD95 ligand; Fas ligand (TNF superfamily, member 6); apoptosis (APO-1) antigen ligand 1; apoptosis antigen ligand; fas antigen ligand; mutant tumor necrosis factor family member 6; tumor necrosis factor ligand 1A; Fas ligand
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagcagcccttcaattacccatatccccagatctactgggtggacagcagtgccagctctccctgggcccctccaggcacagttcttccctgtccaacctctgtgcccagaaggcctggtcaaaggaggccaccaccaccaccgccaccgccaccactaccacctccgccgccgccgccaccactgcctccactaccgctgccacccctgaagaagagagggaaccacagcacaggcctgtgtctccttgtgatgtttttcatggttctggttgccttggtaggattgggcctggggatgtttcagctcttccacctacagaaggagctggcagaactccgagagtctaccagccagatgcacacagcatcatctttggagaagcaaataggccaccccagtccaccccctgaaaaaaaggagctgaggaaagtggcccatttaacaggcaagtccaactcaaggtccatgcctctggaatgggaagacacctatggaattgtcctgctttctggagtgaagtataagaagggtggccttgtgatcaatgaaactgggctgtactttgtatattccaaagtatacttccggggtcaatcttgcaacaacctgcccctgagccacaaggtctacatgaggaactctaagtatccccaggatctggtgatgatggaggggaagatgatgagctactgcactactgggcagatgtgggcccgcagcagctacctgggggcagtgttcaatcttaccagtgctgatcatttatatgtcaacgtatctgagctctctctggtcaattttgaggaatctcagacgtttttcggcttatataagctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: