THAP11-THAP domain containing 11 Gene View larger

THAP11-THAP domain containing 11 Gene

PTXBC012182

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of THAP11-THAP domain containing 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about THAP11-THAP domain containing 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012182
Product type: DNA & cDNA
Ncbi symbol: THAP11
Origin species: Human
Product name: THAP11-THAP domain containing 11 Gene
Size: 2ug
Accessions: BC012182
Gene id: 57215
Gene description: THAP domain containing 11
Synonyms: CTG-B43a; CTG-B45d; HRIHFB2206; RONIN; THAP domain-containing protein 11; THAP domain containing 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctggctttacgtgctgcgtgccaggctgctacaacaactcgcaccgggacaaggcgctgcacttctacacgtttccaaaggacgctgagttgcggcgcctctggctcaagaacgtgtcgcgtgccggcgtcagtgggtgcttctccaccttccagcccaccacaggccaccgtctctgcagcgttcacttccagggcggccgcaagacctacacggtacgcgtccccaccatcttcccgctgcgcggcgtcaatgagcgcaaagtagcgcgcagacccgctggggccgcggccgcccgccgcaggcagcagcagcaacagcagcagcagcagcaacagcagcaacagcagcagcagcagcaacagcagcagcagcagcagcagcagcagtcctcaccctctgcctccactgcccagactgcccagctgcagccgaacctggtatctgcttccgcggccgtgcttctcacccttcaggccactgtagacagcagtcaggctccgggatccgtacagccggcgcccatcactcccactggagaagacgtgaagcccatcgatctcacagtgcaagtggagtttgcagccgcagagggcgcagccgctgcggccgccgcgtcggagttacaggctgctaccgcagggctggaggctgccgagtgccctatgggcccccagttggtggtggtaggggaagagggcttccctgatactggctccgaccattcgtactccttgtcgtcaggcaccacggaggaggagctcctgcgcaagctgaatgagcagcgggacatcctggctctgatggaagtgaagatgaaagagatgaaaggcagcattcgccacctgcgtctcactgaggccaagctgcgcgaagaactgcgtgagaaggatcggctgcttgccatggctgtcatccgcaagaagcacggaatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical LOC152217
- Hermansky-Pudlak syndrome 5
- yippee-like 3 (Drosophila)
- hypothetical LOC284297

Buy THAP11-THAP domain containing 11 Gene now

Add to cart