LOC152217-hypothetical LOC152217 Gene View larger

LOC152217-hypothetical LOC152217 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC152217-hypothetical LOC152217 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LOC152217-hypothetical LOC152217 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007882
Product type: DNA & cDNA
Ncbi symbol: LOC152217
Origin species: Human
Product name: LOC152217-hypothetical LOC152217 Gene
Size: 2ug
Accessions: BC007882
Gene id: 152217
Gene description: hypothetical LOC152217
Synonyms: NCBP2 antisense RNA 2 (head to head)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgctgcggcggctgctggccgccctgctgcacagcccgcagctggtggaacgtctgtcagagtcgcggcctatccgacgtgcggcgcagctcacggccttcgcactgctgcaggcccagctgcggggccaggacgcggcccgccgcctgcaggacctcgcggctgggcccgtgggctccctgtgccgccgcgctgagcgatttagagacgccttcacccaggagctacgccgcggcctccgaggccgctcggggccaccaccaggtagccagaggggccctggcgcaaacatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Hermansky-Pudlak syndrome 5
- yippee-like 3 (Drosophila)
- hypothetical LOC284297
- yippee-like 2 (Drosophila)

Buy LOC152217-hypothetical LOC152217 Gene now

Add to cart