Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
APBA3-amyloid beta (A4) precursor protein-binding, family A, member 3 Gene
PTXBC008338
New product
Data sheet of APBA3-amyloid beta (A4) precursor protein-binding, family A, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about APBA3-amyloid beta (A4) precursor protein-binding, family A, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008338 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | APBA3 |
| Origin species: | Human |
| Product name: | APBA3-amyloid beta (A4) precursor protein-binding, family A, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC008338 |
| Gene id: | 9546 |
| Gene description: | amyloid beta (A4) precursor protein-binding, family A, member 3 |
| Synonyms: | MGC:15815; X11L2; mint3; amyloid beta A4 precursor protein-binding family A member 3; X11-like 2 protein; adapter protein X11gamma; amyloid beta (A4) precursor protein-binding, family A, member 3 (X11-like 2); mint-3; neuron-specific X11L2 protein; neuronal munc18-1-interacting protein 3; phosphotyrosine-binding/-interacting domain (PTB)-bearing protein; amyloid beta precursor protein binding family A member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccaggcccgggaggccatggaccgcgtcaaggcccccgatggggagacccagcccatgacggaggtggacctgttcgtctccaccaagaggatcaaggtcttgacagcggactcccaggaggccatgatggaccacgccctgcataccatctcctacacagccgacatcggctgcgtgctggtgctgatggcgcggcggcggctggcacggaggccggcaccccaggaccacggccgccgcctctacaagatgctctgccacgtattctacgcagaggacgcccagctcatcgcccaggccattggccaggccttcgccgccgcctacagccagttcctacgggaaagcggtattgaccccagccaggtgggcgtgcacccgagcccaggcgcccgccacctccataatggggacctggaccacttctccaacagtgacaactgccgggaggtgcacctcgagaagcggcgaggggagggcctgggcgtggccctggtggagtcgggctggggctccctgctgcccacagccgtcatcgccaacctgctgcacggggggcctgctgagcgctcgggggccctcagcatcggggaccgcctgaccgccatcaacgggaccagcctggtggggctgcccctggctgcgtgccaggccgctgtccgcgagacgaagtcgcagacgtcggtgacactcagcatcgtccactgccctcccgtcaccaccgccatcatccaccggccccacgcccgcgagcagctgggcttctgcgtggaggacggcatcatctgcagcctcctccgtggtggcatcgccgagcgtgggggcatccgcgtcggccaccgcatcattgagatcaatgggcagagtgtggtggccacgccacacgcccgcatcatcgagctgctcaccgaggcctatggcgaggtgcatatcaagacgatgccagctgccacatatcgcctccttacaggccaggagcagcccgtgtacctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translocase of outer mitochondrial membrane 40 homolog (yeast) - interleukin-1 receptor-associated kinase 1 binding protein 1 - Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase - ankyrin repeat, SAM and basic leucine zipper domain containing 1 |