Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
IRAK1BP1-interleukin-1 receptor-associated kinase 1 binding protein 1 Gene
PTXBC112253
New product
Data sheet of IRAK1BP1-interleukin-1 receptor-associated kinase 1 binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IRAK1BP1-interleukin-1 receptor-associated kinase 1 binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC112253 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IRAK1BP1 |
| Origin species: | Human |
| Product name: | IRAK1BP1-interleukin-1 receptor-associated kinase 1 binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC112253 |
| Gene id: | 134728 |
| Gene description: | interleukin-1 receptor-associated kinase 1 binding protein 1 |
| Synonyms: | AIP70; SIMPL; interleukin-1 receptor-associated kinase 1-binding protein 1; ActA binding protein 3; IRAK1-binding protein 1; interleukin 1 receptor associated kinase 1 binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctctgcaaaagacccctccgacccgagtgttcgtggaactggttccctgggctgaccggagccgggagaacaacctggcctcagggagagagacgctaccgggcttacgccaccccctctcctcaacacaagcccaaactgctacccgcgaggtgcaagtaagcggcacctcagaagtgtctgcgggccctgaccgggcgcaggtggtggtgcgagtgagcagcaccaaggaggcggcagccgaggccaaaaagagcgtttgtcgccgtctagattacatcacgcagagcctccagcagcagggcgtgcaggcggaaaatataactgtgacaaaggattttaggagagtggaaaatgcttatcacatggaagcagaggtctgcattacatttactgaatttggaaaaatgcaaaatatttgtaactttcttgttgaaaagctagatagctctgttgtcatcagcccaccccagttctatcatactccaggttctgttgagaatcttcgacggcaagcctgtcttgttgctgttgagaatgcgtggcgcaaagctcaagaagtctgtaaccttgttggccaaaccttaggaaaacctttactaatcaaagaagaagaaacaaaagaatgggaaggccaaatagatgatcaccagtcatccagactctcaagttcattaactgtacaacaaaaaatcaaaagtgcaacaatacatgctgcttcaaaagtatttataacttttgaggtaaagggaaaagagaagagaaaaaagcacctttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase - ankyrin repeat, SAM and basic leucine zipper domain containing 1 - zinc finger protein interacting with K protein 1 homolog (mouse) - membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) |