TOMM40-translocase of outer mitochondrial membrane 40 homolog (yeast) Gene View larger

TOMM40-translocase of outer mitochondrial membrane 40 homolog (yeast) Gene

PTXBC001779

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TOMM40-translocase of outer mitochondrial membrane 40 homolog (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TOMM40-translocase of outer mitochondrial membrane 40 homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001779
Product type: DNA & cDNA
Ncbi symbol: TOMM40
Origin species: Human
Product name: TOMM40-translocase of outer mitochondrial membrane 40 homolog (yeast) Gene
Size: 2ug
Accessions: BC001779
Gene id: 10452
Gene description: translocase of outer mitochondrial membrane 40 homolog (yeast)
Synonyms: C19orf1; D19S1177E; PER-EC1; PEREC1; TOM40; mitochondrial import receptor subunit TOM40 homolog; mitochondrial outer membrane protein; p38.5; protein Haymaker; translocase of outer membrane 40 kDa subunit homolog; translocase of outer mitochondrial membrane 40 homolog; translocase of outer mitochondrial membrane 40
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaacgtgttggctgccagctcgccgcccgcagggccgccaccgccgcctgcgccggccctcgtggggctgccgccacctccgccctcgccgccgggcttcacgctgccgccgctgggaggcagcctgggcgccggcaccagtacgagtcgaagttcggaacggacccccggggctgcaaccgccagcgcctcaggggccgccgaggatggggcctgcggctgcctgcccaacccgggcacattcgaggagtgccaccggaagtgcaaggagctgtttcccattcagatggagggtgtcaagctcacagtcaacaaagggttgagtaaccattttcaggtcaaccacacagtagccctcagcacaatcggggagtccaactaccacttcggggtcacatatgtggggacaaagcagctgagtcccacagaggcgttccctgtactggtgggtgacatggacaacagtggcagtctcaacgctcaggtcattcaccagctgggccccggtctcaggtccaagatggccatccagacccagcagtcgaagtttgtgaactggcaggtggacggggagtatcggggctctgacttcacagcagccgtcaccctggggaacccagacgtcctcgtgggttcaggaatcctcgtagcccactacctccagagcatcacgccttgcctggccctgggtggagagctggtctaccaccggcggcctggagaggagggcactgtcatgtctctagctgggaaatacacattgaacaactggttggcaacggtaacgttgggccaggcgggcatgcacgcaacatactaccacaaagccagtgaccagctgcaggtgggtgtggagtttgaggccagcacaaggatgcaggacaccagcgtctccttcgggtaccagctggacctgcccaaggccaacctcctcttcaaaggctctgtggatagcaactggatcgtgggtgccacgctggagaagaagctcccacccctgcccctgacactggcccttggggccttcctgaatcaccgcaagaacaagtttcagtgtggctttggcctcaccatcggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interleukin-1 receptor-associated kinase 1 binding protein 1
- Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase
- ankyrin repeat, SAM and basic leucine zipper domain containing 1
- zinc finger protein interacting with K protein 1 homolog (mouse)

Buy TOMM40-translocase of outer mitochondrial membrane 40 homolog (yeast) Gene now

Add to cart