Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
C1QBP-complement component 1, q subcomponent binding protein Gene
PTXBC000435
New product
Data sheet of C1QBP-complement component 1, q subcomponent binding protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C1QBP-complement component 1, q subcomponent binding protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000435 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C1QBP |
| Origin species: | Human |
| Product name: | C1QBP-complement component 1, q subcomponent binding protein Gene |
| Size: | 2ug |
| Accessions: | BC000435 |
| Gene id: | 708 |
| Gene description: | complement component 1, q subcomponent binding protein |
| Synonyms: | GC1QBP; HABP1; SF2p32; gC1Q-R; gC1qR; p32; complement component 1 Q subcomponent-binding protein, mitochondrial; ASF/SF2-associated protein p32; C1q globular domain-binding protein; complement component 1, q subcomponent binding protein; glycoprotein gC1qBP; hyaluronan-binding protein 1; mitochondrial matrix protein p32; p33; splicing factor SF2-associated protein; complement C1q binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcctctgctgcgctgcgtgccccgtgtgctgggctcctccgtcgccggcctccgcgctgccgcgcccgcctcgcctttccggcagctcctgcagccggcaccccggctgtgcacccggcccttcgggctgctcagcgtgcgcgcaggttccgagcggcggccgggcctcctgcggcctcgcggaccctgcgcctgtggctgtggctgcggctcgctgcacaccgacggagacaaagcttttgttgatttcctgagtgatgaaattaaggaggaaagaaaaattcagaagcataaaaccctccctaagatgtctggaggttgggagctggaactgaatgggacagaagcgaaattagtgcggaaagttgccggggaaaaaatcacggtcactttcaacattaacaacagcatcccaccaacatttgatggtgaggaggaaccctcgcaagggcagaaggttgaagaacaggagcctgaactgacatcaactcccaatttcgtggttgaagttataaagaatgatgatggcaagaaggcccttgtgttggactgtcattatccagaggatgaggttggacaagaagacgaggctgagagtgacatcttctctatcagggaagttagctttcagtccactggcgagtctgaatggaaggatactaattatacactcaacacagattccttggactgggccttatatgaccacctaatggatttccttgccgaccgaggggtggacaacacttttgcagatgagctggtggagctcagcacagccctggagcaccaggagtacattacttttcttgaagacctcaagagttttgtcaagagccagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - killer cell lectin-like receptor subfamily C, member 1 - major histocompatibility complex, class II, DM alpha - ATP-binding cassette, sub-family B (MDR/TAP), member 9 - major histocompatibility complex, class II, DO alpha |