Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HLA-DMA-major histocompatibility complex, class II, DM alpha Gene
PTXBC011447
New product
Data sheet of HLA-DMA-major histocompatibility complex, class II, DM alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HLA-DMA-major histocompatibility complex, class II, DM alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011447 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HLA-DMA |
| Origin species: | Human |
| Product name: | HLA-DMA-major histocompatibility complex, class II, DM alpha Gene |
| Size: | 2ug |
| Accessions: | BC011447 |
| Gene id: | 3108 |
| Gene description: | major histocompatibility complex, class II, DM alpha |
| Synonyms: | D6S222E; DMA; HLADM; RING6; HLA class II histocompatibility antigen, DM alpha chain; MHC class II antigen DMA; class II histocompatibility antigen, M alpha chain; really interesting new gene 6 protein; major histocompatibility complex, class II, DM alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtcatgaacagaaccaaggagctgcgctgctacagatgttaccacttctgtggctgctaccccactcctgggccgtccctgaagctcctactccaatgtggccagatgacctgcaaaaccacacattcctgcacacagtgtactgccaggatgggagtcccagtgtgggactctctgaggcctacgacgaggaccagcttttcttcttcgacttttcccagaacactcgggtgcctcgcctgcccgaatttgctgactgggctcaggaacagggagatgctcctgccattttatttgacaaagagttctgcgagtggatgatccagcaaatagggccaaaacttgatgggaaaatcccggtgtccagagggtttcctatcgctgaagtgttcacgctgaagcccctggagtttggcaagcccaacactttggtctgttttgtcagtaatctcttcccacccatgctgacagtgaactggcagcatcattccgtccctgtggaaggatttgggcctacttttgtctcagctgtcgatggactcagcttccaggccttttcttacttaaacttcacaccagaaccttctgacattttctcctgcattgtgactcacgaaattgaccgctacacagcaattgcctattgggtaccccggaacgcactgccctcagatctgctggagaatgtgctgtgtggcgtggcctttggcctgggtgtgctgggcatcatcgtgggcattgttctcatcatctacttccggaagccttgctcaggtgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATP-binding cassette, sub-family B (MDR/TAP), member 9 - major histocompatibility complex, class II, DO alpha - cleavage and polyadenylation specific factor 1, 160kDa - myristoylated alanine-rich protein kinase C substrate |