ABCB9-ATP-binding cassette, sub-family B (MDR/TAP), member 9 Gene View larger

ABCB9-ATP-binding cassette, sub-family B (MDR/TAP), member 9 Gene


New product

Data sheet of ABCB9-ATP-binding cassette, sub-family B (MDR/TAP), member 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ABCB9-ATP-binding cassette, sub-family B (MDR/TAP), member 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017348
Product type: DNA & cDNA
Ncbi symbol: ABCB9
Origin species: Human
Product name: ABCB9-ATP-binding cassette, sub-family B (MDR/TAP), member 9 Gene
Size: 2ug
Accessions: BC017348
Gene id: 23457
Gene description: ATP-binding cassette, sub-family B (MDR/TAP), member 9
Synonyms: EST122234; TAPL; ATP-binding cassette sub-family B member 9; ABC transporter 9 protein; ATP-binding cassette, sub-family B (MDR/TAP), member 9; TAP-like protein; ATP binding cassette subfamily B member 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggctgtggaaggcggtggtggtgactttggccttcatgagtgtggacatctgcgtgaccacggccatctatgtcttcagccacctggaccgcagcctcctggaggacatccgccacttcaacatctttgactcggtgctggatctctgggcagcctgcctgtaccgcagctgcctgctgctgggagccaccattggtgtggccaagaacagtgcgctggggccccggcggctgcgggcctcgtggctggtcatcaccctcgtgtgcctcttcgtgggcatctatgccatggtgaagctgctgctcttctcagaggtgcgcaggcccatccgggacccctggttttgggccctgttcgtgtggacgtacatttcactcggcgcatccttcctgctctggtggctgctgtccaccgtgcggccaggcacccaggccctggagccaggggcggccaccgaggctgagggcttccctgggagcggccggccaccgcccgagcaggcgtctggggccacgctgcagaagctgctctcctacaccaagcccgacgtggccttcctcgtggccgcctccttcttcctcatcgtggcagctctgggagagaccttcctgccctactacacgggccgcgccattgatggcatcgtcatccagaaaagcatggatcagttcagcacggctgtcgtcatcgtgtgcctgctggccattggcagctcatttgccgcaggtattcggggcggcatttttaccctcatatttgccagactgaacattcgccttcgaaactgtctcttccgctcactggtgtcccaggagacaagcttctttgatgagaaccgcacaggggacctcatctcccgcctgacctcggacaccaccatggtcagcgacctggtctcccagaacatcaatgtcttcctgcggaacacagtcaaggtcacgggcgtggtggtcttcatgttcagcctctcatggcagctctccttggtcaccttcatgggcttccccatcatcatgatggtgtccaacatctacggcaagtactacaagaggctctccaaagaggtccagaatgccctggccagagcgagcaacacggcggaggagaccatcagtgccatgaagactgtccggagcttcgccaatgaggaggaggaggcagaggtgtacctgcggaagctgcagcaggtgtacaagctgaacaggaaggaggcagctgcctacatgtactacgtctggggcagcgggctcacactgctggtggtccaggtcagcatcctctactacgggggccaccttgtcatctcaggccagatgaccagcggcaacctcatcgccttcatcatctacgagtttgtcctgggagattgtatggagtccgtgggctccgtctacagtggcctgatgcagggagtgggggctgctgagaaggtgttcgagttcatcgaccggcagccgaccatggtgcacgatggcagcttggcccccgaccacctggagggccgggtggactttgagaatgtgaccttcacctaccgcactcggccccacacccaggtcctgcagaatgtctccttcagcctgtcccccggcaaggtgacggccctggtggggccctcgggcagtgggaagagctcctgtgtcaacatcctggagaacttctaccccctggaggggggccgggtgctgctggacggcaagcccatcagcgcctacgaccacaagtacttgcaccgtgtggtatgtgcacgggcctgggccacacttctccgccctttctgcatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major histocompatibility complex, class II, DO alpha
- cleavage and polyadenylation specific factor 1, 160kDa
- myristoylated alanine-rich protein kinase C substrate
- methylmalonic aciduria (cobalamin deficiency) cblB type

Buy ABCB9-ATP-binding cassette, sub-family B (MDR/TAP), member 9 Gene now

Add to cart