Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RHOD-ras homolog gene family, member D Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RHOD-ras homolog gene family, member D Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001338 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RHOD |
| Origin species: | Human |
| Product name: | RHOD-ras homolog gene family, member D Gene |
| Size: | 2ug |
| Accessions: | BC001338 |
| Gene id: | 29984 |
| Gene description: | ras homolog gene family, member D |
| Synonyms: | rho-related GTP-binding protein RhoD; ARHD; RHOHP1; RHOM; Rho; Rho-related protein HP1; ras homolog D; ras homolog gene family, member A; ras homolog gene family, member D; ras homolog family member D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacggcggcccaggccgcgggtgaggaggcgccaccaggcgtgcggtccgtcaaggtggtcctggtgggcgacggcggctgcgggaagacgtcgctgctgatggtcttcgccgatggggccttccccgagagctacacccccacggtgtttgagcggtacatggtcaacctgcaagtgaaaggcaaacctgtgcacctccacatctgggacacagcagggcaagatgactatgaccgcctgcggcccctgttctaccctgacgccagcgtcctgctgctttgcttcgatgtcaccagcccgaacagctttgacaacatctttaaccggtggtacccagaagtgaatcatttctgcaagaaggtacccatcatcgtcgtgggctgcaagactgacctgcgcaaggacaaatcactggtgaacaagctccgaagaaacggattggagcctgtgacctaccacaggggccaggagatggcgaggtccgtgggcgcggtggcctacctcgagtgctcggctcggctccatgacaacgtccacgccgtcttccaggaggccgccgaggtggccctcagcagccgcggtcgcaacttctggcggcggattacccagggcttttgcgtggtgacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein MGC34800 - ribonuclease P/MRP 25kDa subunit - heat shock transcription factor 2 - hypothetical protein FLJ21438 |