Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RPP25-ribonuclease P/MRP 25kDa subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPP25-ribonuclease P/MRP 25kDa subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002497 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPP25 |
| Origin species: | Human |
| Product name: | RPP25-ribonuclease P/MRP 25kDa subunit Gene |
| Size: | 2ug |
| Accessions: | BC002497 |
| Gene id: | 54913 |
| Gene description: | ribonuclease P/MRP 25kDa subunit |
| Synonyms: | ribonuclease P protein subunit p25; RNase P protein subunit p25; ribonuclease P 25kDa subunit; ribonuclease P/MRP 25kDa subunit; ribonuclease P/MRP subunit p25 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaacttccgtaaggtgcgctccgaagaggcgccagcggggtgcggggccgagggaggcggcccgggctccggccccttcgcagacctggcgccgggcgcggtgcacatgcgggtcaaggaaggcagcaagatccggaacctgatggccttcgccaccgccagcatggcgcagccagccacgcgcgccatcgtcttcagcggctgcggccgggccaccaccaaaaccgtcacgtgcgccgagatcctcaagcgccgcctggcgggcctgcaccaggtcacgcggctgcgctaccggagcgtacgcgaggtgtggcagagcctcccgcctgggcccacgcagggtcagacgcctggcgagccggccgctagtctcagcgtacttaagaacgtgcccggcctcgccatcctactttccaaggacgcgctggatccgcgacagcccggctaccagcccccgaatccccatcctggtccctcgtccccgccagccgcgccagcgtccaagaggagcctaggggaacccgcagctggagaaggctccgcgaagcgatcgcaacccgagccaggggttgcggacgaggatcagacggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heat shock transcription factor 2 - hypothetical protein FLJ21438 - SET and MYND domain containing 4 - tuftelin interacting protein 11 |