Cart 32 Product Products 5 481,63 € (empty)
-
1 x HIST1H2AH-...113,40 € -
-
1 x LOC123688-...113,40 € -
-
1 x ABHD13-abh...113,40 € -
1 x LINS1-line...121,50 € -
1 x MEOX1-mese...113,40 € -
-
-
-
1 x DRG1-devel...121,50 € -
1 x ZDHHC24-zi...121,50 € -
1 x DTD1-D-tyr...113,40 € -
1 x B3GAT2-bet...113,40 € -
1 x DRD3-dopam...121,50 € -
-
-
1 x ABHD11-abh...113,40 € -
1 x RDH5-retin...121,50 € -
-
-
-
-
1 x DSTN-destr...113,40 € -
1 x VGLL4-vest...121,50 € -
1 x C4orf35-ch...121,50 € -
1 x AMICA1-adh...121,50 € -
-
-
1 x DPH3-DPH3,...113,40 € -
1 x PTGER3-pro...121,50 € -
No products
To be determined Shipping
5 481,63 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 32 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 481,63 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 481,63 €
Data sheet of FLJ21438-hypothetical protein FLJ21438 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ21438-hypothetical protein FLJ21438 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030281 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ21438 |
| Origin species: | Human |
| Product name: | FLJ21438-hypothetical protein FLJ21438 Gene |
| Size: | 2ug |
| Accessions: | BC030281 |
| Gene id: | 64926 |
| Gene description: | hypothetical protein FLJ21438 |
| Synonyms: | RAS protein activator like-3; RAS protein activator like 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgtctcccactgcccccggcccaggtccactccagcctctccgcaggggagaagcccggcttcctggccccccgggacctccccaagcacacccctctcatctccaagagccagtctctgcgcagcgttcgccgctcagagagttgggcccggccacggccggacgaagagcggcccctgcggcggccccggccggtgcagcgcacgcagagtgtcccggtccggcgtcctgcccgccgccgccaatctgcggggccctggccgcgacccaaaggctccctgagcatgggaccagcgccccgcgcccggccttggacccgggactccgcctcgctgcctcggaagccgtcggtaccctggcagcgccaaatggaccagccgcaagaccgaaaccaggcactgggcacgcaccgacctgtgaacaagttggcagagctgcagtgcgaggtggccgctctgcgtgaggagcagaaagtgctgtcccgcctcgtggagtcgctgagcacccaaatccgggccttgacggagcagcaggagcagctgcggggccagctgcaggatctggactccaggctccgtgctgggagctcagagtttgattcagagcacaacctaacaagcaatgaagggcacagtctgaaaaacctggagcaccgcctaaatgagatggagagaactcaggctcagctgagggatgctgtccagagcctgcagctttctccaaggacgcgggggtcttggagtcaaccccagcccctcaaagcaccctgcctcaatggagacaccacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SET and MYND domain containing 4 - tuftelin interacting protein 11 - ribonuclease P/MRP 30kDa subunit - synaptonemal complex protein SC65 |