SC65-synaptonemal complex protein SC65 Gene View larger

SC65-synaptonemal complex protein SC65 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SC65-synaptonemal complex protein SC65 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SC65-synaptonemal complex protein SC65 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001047
Product type: DNA & cDNA
Ncbi symbol: SC65
Origin species: Human
Product name: SC65-synaptonemal complex protein SC65 Gene
Size: 2ug
Accessions: BC001047
Gene id: 10609
Gene description: synaptonemal complex protein SC65
Synonyms: synaptonemal complex protein SC65; SC65; LEPREL4; NO55; NOL55; leprecan-like 4; leprecan-like protein 4; nucleolar autoantigen (55kD); nucleolar autoantigen No55; nucleolar autoantigen, 55kDa; prolyl 3-hydroxylase family member 4 (non-enzymatic)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcgggtggcgtgggggctgctgtggttgctgctgggcagcgccggggcgcagtacgagaagtacagcttccggggcttcccgcccgaggacctgatgccgctggccgcggcgtacgggcacgctctggagcagtacgagggagagagctggcgcgagagcgcgcgctacctggaggcggcgctgcggctgcaccggctcctgcgcgacagcgaggccttctgccacgccaactgcagcggccccgcgcccgcggccaagcccgatcccgacggcggccgcgcagacgagtgggcctgcgagctgcggctcttcggccgcgtcctggagcgagccgcctgcctgcggcgctgcaagcggacgctgcccgccttccaggtgccctacccgccgcggcagctgctgcgtgacttccagagccgcctgccctaccagtacctgcactacgcgctgttcaaggctaaccggctggagaaggcggtggcggcggcctacaccttcctccagaggaacccgaagcacgagctgaccgccaagtatctcaactactatcaggggatgctggacgtcgccgacgagtccctcacggacctagaggcccagccctacgaggccgtgttcctccgggctgtgaagctctacaacagcggggatttccgcagcagcacggaggacatggagcgggccttgtcagagtacctggcagtctttgcccggtgcctggccggctgtgaaggggcccatgagcaggtggacttcaaggacttctacccggccatagcagatctctttgcagagtccctgcagtgcaaggtggactgtgaggccaatttgacccccaatgtgggtggctacttcgtggacaagttcgtggccaccatgtaccactacctgcagtttgcctactataagttgaatgatgtgcgccaggctgcccgcagcgccgccagctacatgctcttcgaccccaaggacagcgtcatgcagcagaacctggtgtattaccggttccaccgggctcgctggggcctggaagaggaggacttccagccccgggaggaggccatgctctaccacaaccagaccgccgagctgcgggagctgctggagttcacccacatgtacctgcagtcagatgatgagatggagctggaggagacagaaccgcccctggagcctgaggatgccctatctgacgccgagtttgagggggagggtgactacgaggagggcatgtatgctgactggtggcaggagccggatgccaagggtgacgaggccgaggctgagccagagcctgaactcgcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine rich repeat containing 1
- EF-hand domain family, member D1
- hypothetical protein MGC10981
- POM121 membrane glycoprotein C

Buy SC65-synaptonemal complex protein SC65 Gene now

Add to cart