EFHD1-EF-hand domain family, member D1 Gene View larger

EFHD1-EF-hand domain family, member D1 Gene

PTXBC002449

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EFHD1-EF-hand domain family, member D1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EFHD1-EF-hand domain family, member D1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002449
Product type: DNA & cDNA
Ncbi symbol: EFHD1
Origin species: Human
Product name: EFHD1-EF-hand domain family, member D1 Gene
Size: 2ug
Accessions: BC002449
Gene id: 80303
Gene description: EF-hand domain family, member D1
Synonyms: MST133; MSTP133; PP3051; SWS2; EF-hand domain-containing protein D1; EF-hand domain-containing protein 1; swiprosin-2; EF-hand domain family member D1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagtgaggagctggcgtgcaagctggagcgccggctgcggcgcgaggaggccgaggagagtggcccccagctggctcccctcggcgccccagccccggagcccaagcccgagcccgagcctcccgcccgtgcgcccacggccagcgccgacgcggagctgagcgcccagctgagccggcggctggacatcaacgagggcgctgcgcggccccggcgctgcagggtcttcaacccctacacggagttcccggagttcagccgccgcctcatcaaggacctggagagcatgttcaaactgtatgacgctgggcgggatggcttcatcgacctgatggagctgaagctgatgatggagaagctgggggccccccagacccacctgggcctgaagagcatgatcaaggaggtggatgaggacttcgatggcaagctcagcttccgggagttcctgctcattttccacaaggccgcggcaggggagctgcaggaggacagtgggctgatggcgctggcaaagctttctgagatcgatgtggccctggagggtgtcaaaggtgccaagaacttctttgaagccaaggtccaagccttgtcatcggccagtaagtttgaagcagagttgaaagctgagcaagatgagcggaagcgggaggaggaggagaggcggctccgccaggcagccttccagaaactcaaggccaacttcaatacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein MGC10981
- POM121 membrane glycoprotein C
- serine PI Kazal type 5-like 3
- hypothetical protein FLJ25404

Buy EFHD1-EF-hand domain family, member D1 Gene now

Add to cart