Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SPINK5L3-serine PI Kazal type 5-like 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPINK5L3-serine PI Kazal type 5-like 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC128164 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPINK5L3 |
| Origin species: | Human |
| Product name: | SPINK5L3-serine PI Kazal type 5-like 3 Gene |
| Size: | 2ug |
| Accessions: | BC128164 |
| Gene id: | 153218 |
| Gene description: | serine PI Kazal type 5-like 3 |
| Synonyms: | SPINK5L3; HBVDNAPTP1; HESPINTOR; LiESP6; serine protease inhibitor Kazal-type 13; Hepatitis B Virus (HBV) DNA polymerase transactivated protein 1; hepatitis B virus DNA polymerase transactivated human serine protease inhibitor; hepatitis B virus DNA polymerase transactivated serine protease inhibitor; serine protease inhibitor Kazal-type 5-like 3; serine peptidase inhibitor, Kazal type 13 (putative) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcctttccccacaagattatatttttcctggtatgctctactttgacacatgtggctttctcaggaattttcaataaacgtgacttcactaggtggcctaagccccgatgtaaaatgtatatcccactggaccctgattacaatgcagactgccccaatgtgacagcacctgtttgtgcctcaaatggccacactttccagaatgagtgtttcttttgtgttgaacagagggaatttcattatcgtataaaatttgaaaaatatggaaaatgtgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein FLJ25404 - adenine phosphoribosyltransferase - thioredoxin domain containing 6 - hypothetical protein FLJ40448 |