No products
Prices are tax excluded
PTXBC016927
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC016927 |
Product type: | DNA & cDNA |
Ncbi symbol: | AKAP7 |
Origin species: | Human |
Product name: | AKAP7-A kinase (PRKA) anchor protein 7 Gene |
Size: | 2ug |
Accessions: | BC016927 |
Gene id: | 9465 |
Gene description: | A kinase (PRKA) anchor protein 7 |
Synonyms: | AKAP15; AKAP18; A-kinase anchor protein 7 isoform gamma; A kinase (PRKA) anchor protein 7; A-kinase anchor protein 18 kDa; A-kinase anchor protein 7 isoforms alpha and beta; A-kinase anchor protein 9 kDa; AKAP 18; AKAP-7 isoform gamma; AKAP-7 isoforms alpha and beta; PRKA7 isoform gamma; PRKA7 isoforms alpha/beta; A-kinase anchoring protein 7 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgggccagctttgctgctttcctttctcaagagatgaaggaaaaatcagtgaaaagaacggaggggagcccgatgacgctgaactagtaaggctcagtaagaggctggtggagaacgcggtgctcaaggctgtccagcagtatctggaggaaacacagaataaaaacaagccgggggaggggagctctgtgaaaaccgaagcagctgatcagaatggcaatgacaatgagaacaacaggaaatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - ras homolog gene family, member D - hypothetical protein MGC34800 - ribonuclease P/MRP 25kDa subunit - heat shock transcription factor 2 |