Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of AKAP7-A kinase (PRKA) anchor protein 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AKAP7-A kinase (PRKA) anchor protein 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016927 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AKAP7 |
| Origin species: | Human |
| Product name: | AKAP7-A kinase (PRKA) anchor protein 7 Gene |
| Size: | 2ug |
| Accessions: | BC016927 |
| Gene id: | 9465 |
| Gene description: | A kinase (PRKA) anchor protein 7 |
| Synonyms: | AKAP15; AKAP18; A-kinase anchor protein 7 isoform gamma; A kinase (PRKA) anchor protein 7; A-kinase anchor protein 18 kDa; A-kinase anchor protein 7 isoforms alpha and beta; A-kinase anchor protein 9 kDa; AKAP 18; AKAP-7 isoform gamma; AKAP-7 isoforms alpha and beta; PRKA7 isoform gamma; PRKA7 isoforms alpha/beta; A-kinase anchoring protein 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggccagctttgctgctttcctttctcaagagatgaaggaaaaatcagtgaaaagaacggaggggagcccgatgacgctgaactagtaaggctcagtaagaggctggtggagaacgcggtgctcaaggctgtccagcagtatctggaggaaacacagaataaaaacaagccgggggaggggagctctgtgaaaaccgaagcagctgatcagaatggcaatgacaatgagaacaacaggaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ras homolog gene family, member D - hypothetical protein MGC34800 - ribonuclease P/MRP 25kDa subunit - heat shock transcription factor 2 |