Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FBXW5-F-box and WD repeat domain containing 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FBXW5-F-box and WD repeat domain containing 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000850 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FBXW5 |
| Origin species: | Human |
| Product name: | FBXW5-F-box and WD repeat domain containing 5 Gene |
| Size: | 2ug |
| Accessions: | BC000850 |
| Gene id: | 54461 |
| Gene description: | F-box and WD repeat domain containing 5 |
| Synonyms: | Fbw5; F-box/WD repeat-containing protein 5; F-box and WD-40 domain-containing protein 5; WD repeat-containing F-box protein FBW5; F-box and WD repeat domain containing 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcctgtcgcccgacaacaggtacctgtacgtgaacagccgcgcctggcccaacggtgcggtggtggccgaccccatgcagccgccaccaatcgcggaggagattgacctgctggtgttcgacctcaagaccatgcgggaggtgaggcgggctctgcgtgcgcaccgcgcctacacgcccaacgacgagtgcttcttcatcttcctggacgtcagcagggacttcgtggccagcggggcggaggaccggcacggctacatctgggaccgccactacaacatctgtctggccaggctgcggcacgaggatgtggtcaactcagtggtcttcagtccccaggagcaggagctgctgctcacggccagcgacgacgccaccatcaaagcctggcgctccccacgcaccatgcgcgtcctccaggcacctcgcccacggcctcgcaccttcttctcctggcttgccagccagaggcgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coenzyme Q10 homolog B (S. cerevisiae) - F-box and leucine-rich repeat protein 8 - DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 - outer dense fiber of sperm tails 2-like |