COQ10B-coenzyme Q10 homolog B (S. cerevisiae) Gene

View larger

COQ10B-coenzyme Q10 homolog B (S. cerevisiae) Gene

Reference: PTXBC022453

Condition: New product

Print

Data sheet of COQ10B-coenzyme Q10 homolog B (S. cerevisiae) Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about COQ10B-coenzyme Q10 homolog B (S. cerevisiae) Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC022453
Product type:	DNA & cDNA
Ncbi symbol:	COQ10B
Origin species:	Human
Product name:	COQ10B-coenzyme Q10 homolog B (S. cerevisiae) Gene
Size:	2ug
Accessions:	BC022453
Gene id:	80219
Gene description:	coenzyme Q10 homolog B (S. cerevisiae)
Synonyms:	coenzyme Q-binding protein COQ10 homolog B, mitochondrial; coenzyme Q10 homolog B; coenzyme Q10B
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggcagctcggactggtcatacggccttgagaagggtagtctcgggatgccgtccgaagtcggcgacagcggccggggcgcaggcgcccgtgcggaatggcagatatttagcttcctgtggtatactgatgagcagaactcttccactacatacctcaattttgcctaaggagatatgtgcacgaactttcttcaaaatcactgcaccattaataaacaaaaggaaagaatattcagagagaagaattttaggatattcaatgcaggaaatgtatgatgtagtatcgggagtggaggattacaagcattttgttccttggtgcaaaaaatcagatgttatatcaaagagatctggatattgtaaaacaagattagaaattggatttccacctgtgttggagcgatatacatcagtagtaaccttggtgaaacctcatttagtaaaggcatcttgtactgatgggagacttttcaatcatttggagactatttggcgttttagcccaggtcttcctggctacccaagaacttgtaccttggatttttcaatttcttttgaatttcgatcacttctacattcccagcttgccacactcttttttgatgaagttgtgaagcagatggtagctgcctttgaaagaagagcatgtaagctgtatggtccagaaacaaatatacctcgggagttaatgcttcatgaagtccatcacacataa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- F-box and leucine-rich repeat protein 8 - DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 - outer dense fiber of sperm tails 2-like - isocitrate dehydrogenase 3 (NAD+) alpha

Reviews

Be the first to write your review !

Buy COQ10B-coenzyme Q10 homolog B (S. cerevisiae) Gene now