PTXBC009779
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009779 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ODF2L |
| Origin species: | Human |
| Product name: | ODF2L-outer dense fiber of sperm tails 2-like Gene |
| Size: | 2ug |
| Accessions: | BC009779 |
| Gene id: | 57489 |
| Gene description: | outer dense fiber of sperm tails 2-like |
| Synonyms: | dJ977L11.1; outer dense fiber protein 2-like; outer dense fiber of sperm tails 2 like |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgctagaaaatctaactgataatgaaagtgaaaatactaatcttaagaagaaggtatttgaaaaggaggcccatatccaagaactttcttgtttgtttcagagtgaaaagagcttagaaaccaagatagccaagtggaacctgcaatcaagaatgaataagaatgaggctatagtgatgaaagaagcaagtaggcaaaaaactgtagctttaaaaaaaggcatctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - isocitrate dehydrogenase 3 (NAD+) alpha - methionine adenosyltransferase II, beta - poly(A) binding protein, cytoplasmic 1 - zinc finger and BTB domain containing 9 |