No products
Prices are tax excluded
PTXBC020571
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC020571 |
Product type: | DNA & cDNA |
Ncbi symbol: | SLC39A3 |
Origin species: | Human |
Product name: | SLC39A3-solute carrier family 39 (zinc transporter), member 3 Gene |
Size: | 2ug |
Accessions: | BC020571 |
Gene id: | 29985 |
Gene description: | solute carrier family 39 (zinc transporter), member 3 |
Synonyms: | ZIP-3; ZIP3; zinc transporter ZIP3; solute carrier family 39 (zinc transporter), member 3; zrt- and Irt-like protein 3; solute carrier family 39 member 3 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggtgaaattgctagtggccaaaatcctgtgcatggtgggcgtgttcttcttcatgctgctcggctccctgctccccgtgaagatcatcgagacagattttgagaaggcccatcgctcgaaaaagatcctctctctctgcaacacctttggaggaggggtgtttctggccacgtgcttcaacgctctgctgcccgctgtgagggaaaaggtaagggctccctgggcactagcagcagcccttggcaccttatggccaagggactctgatgcattttcaacactgatgccaagttcagtgaaggccttgatgctgtaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - dehydrogenase E1 and transketolase domain containing 1 - general transcription factor IIF, polypeptide 1, 74kDa - potassium channel tetramerisation domain containing 15 - synuclein, alpha (non A4 component of amyloid precursor) |