Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GUCY1A3-guanylate cyclase 1, soluble, alpha 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GUCY1A3-guanylate cyclase 1, soluble, alpha 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012627 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GUCY1A3 |
| Origin species: | Human |
| Product name: | GUCY1A3-guanylate cyclase 1, soluble, alpha 3 Gene |
| Size: | 2ug |
| Accessions: | BC012627 |
| Gene id: | 2982 |
| Gene description: | guanylate cyclase 1, soluble, alpha 3 |
| Synonyms: | GC-SA3; GUC1A3; GUCA3; GUCSA3; GUCY1A1; MYMY6; guanylate cyclase soluble subunit alpha-3; GC-S-alpha-1; GCS-alpha-3; guanylate cyclase 1, soluble, alpha 3; soluble guanylate cyclase large subunit; guanylate cyclase 1 soluble subunit alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttctgcacgaagctcaaggatctcaagatcacaggagagtgtcctttctccttactggcaccaggtcaagttcctaacgagtcttcagaggaggcagcaggaagctcagagagctgcaaagcaaccgtgcccatctgtcaagacattcctgagaagaacatacaagaaagtcttcctcaaagaaaaaccagtcggagccgagtctatcttcacactttggcagagagtatttgcaaactgattttcccagagtttgaacggctgaatgttgcacttcagagaacattggcaaagcacaaaataaaagaaagcaggaaatctttggaaagagaagactttgaaaaaacaattgcagagcaagcagttgcagcaggtggagaccattggcgatgcctattgtgtagctgggggattacacaaagagagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - F-box and WD repeat domain containing 5 - coenzyme Q10 homolog B (S. cerevisiae) - F-box and leucine-rich repeat protein 8 - DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 |