Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SLURP1-secreted LY6/PLAUR domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLURP1-secreted LY6/PLAUR domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069292 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLURP1 |
| Origin species: | Human |
| Product name: | SLURP1-secreted LY6/PLAUR domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC069292 |
| Gene id: | 57152 |
| Gene description: | secreted LY6/PLAUR domain containing 1 |
| Synonyms: | ANUP; ARS; ArsB; LY6LS; MDM; secreted Ly-6/uPAR-related protein 1; ARS(component B)-81/S; SLURP-1; anti-neoplastic urinary protein; lymphocyte antigen 6-like secreted; secreted Ly6/uPAR related protein 1; secreted LY6/PLAUR domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctctcgctgggctgtgcagctgctgctcgtggcagcctggagcatgggctgtggtgaggccctcaagtgctacacctgcaaggagcccatgaccagtgcttcctgcaggaccattacccgctgcaagccagaggacacagcctgcatgaccacgctggtgacggtggaggcagagtaccccttcaaccagagccccgtggtgacccgctcctgctccagctcctgtgtggccaccgaccccgacagcatcggggccgcccacctgatcttctgctgcttccgagacctctgcaactcggaactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NOL1/NOP2/Sun domain family, member 5C - UV radiation resistance associated gene - guanylate cyclase 1, soluble, alpha 3 - F-box and WD repeat domain containing 5 |