Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MLLT10-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 10 Gene
PTXBC080577
New product
Data sheet of MLLT10-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MLLT10-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC080577 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MLLT10 |
| Origin species: | Human |
| Product name: | MLLT10-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 10 Gene |
| Size: | 2ug |
| Accessions: | BC080577 |
| Gene id: | 8028 |
| Gene description: | myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 |
| Synonyms: | AF10; protein AF-10; ALL1-fused gene from chromosome 10 protein; myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10; type I AF10 protein; type III AF10 protein; type IV AF10 protein; myeloid/lymphoid or mixed-lineage leukemia; translocated to, 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtctctagcgaccggcccgtgtcactggaggacgaggtctcccatagtatgaaggagatgattggaggctgttgcgtttgctcagacgagagaggctgggccgagaacccgctggtttattgcgacgggcacggctgcagcgtcgcggtgcatcaagcttgctatggcattgttcaagtacccactggaccgtggttttgcaggaaatgtgaatctcaggagagagcagccagagtggcagagtctcgctctgttgcccaggctaaagtgcagtggtgtgatctcagcccactgcaacctctgctccccgggttcaagcgattctcctgcctcagcctcccaaatggtatgcaattcctgttggttagcctcatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein - succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa - non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase) - non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) |