GDE1-glycerophosphodiester phosphodiesterase 1 Gene View larger

GDE1-glycerophosphodiester phosphodiesterase 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GDE1-glycerophosphodiester phosphodiesterase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GDE1-glycerophosphodiester phosphodiesterase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001538
Product type: DNA & cDNA
Ncbi symbol: GDE1
Origin species: Human
Product name: GDE1-glycerophosphodiester phosphodiesterase 1 Gene
Size: 2ug
Accessions: BC001538
Gene id: 51573
Gene description: glycerophosphodiester phosphodiesterase 1
Synonyms: 363E6.2; MIR16; glycerophosphodiester phosphodiesterase 1; RGS16-interacting membrane protein; membrane interacting protein of RGS16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggctgtgggaggaccagggcggcctcctgggccctttctccttcctgctgctagtgctgctgctggtgacgcggagcccggtcaatgcctgcctcctcaccggcagcctcttcgttctactgcgcgtcttcagctttgagccggtgccctcttgcagggccctgcaggtgctcaagccccgggaccgcatttctgccatcgcccaccgtggcggcagccacgacgcgcccgagaacacgctggcggccattcggcagctaagaatggagcaacaggcgtggagttggacattgagtttacttctgacgggattcctgtcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, FYVE domain containing 26
- C-type lectin domain family 7, member A
- cytotoxic and regulatory T cell molecule
- melanocortin 2 receptor accessory protein

Buy GDE1-glycerophosphodiester phosphodiesterase 1 Gene now

Add to cart