ZFYVE26-zinc finger, FYVE domain containing 26 Gene View larger

ZFYVE26-zinc finger, FYVE domain containing 26 Gene

PTXBC008927

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZFYVE26-zinc finger, FYVE domain containing 26 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZFYVE26-zinc finger, FYVE domain containing 26 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008927
Product type: DNA & cDNA
Ncbi symbol: ZFYVE26
Origin species: Human
Product name: ZFYVE26-zinc finger, FYVE domain containing 26 Gene
Size: 2ug
Accessions: BC008927
Gene id: 23503
Gene description: zinc finger, FYVE domain containing 26
Synonyms: FYVE-CENT; SPG15; zinc finger FYVE domain-containing protein 26; FYVE domain-containing centrosomal protein; spastizin; zinc finger, FYVE domain containing 26; zinc finger FYVE-type containing 26
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaacacctactaccaggaatgcctcttctacctgcacaactatagcaccaacctggccatcatcagcttctacgtgaggcacagctgcctgcgggaagctcttctgcaccttctcaacaaggagagtcctccagaagtttttatagaaggcattttccaaccaagctataaaagtgggaagctacacactttggagaacttgctagaatccattgatccaaccttggagagctggggaaagtacttgattgctgcctgccaacatttacagaagaagaactactaccacattctgtatgagctgcagcagtttatgaaggaccaagttcgggccgccatgacctgtattcggttcttcagtcacaaagcaaagtcatatacagaactgggagagaagctctcatggctacttaaggccaaggaccacctgaagatctacctccaagaaacatcccgcagctctggaaggaagaaaaccacattcttcagaaagaagatgactgcagctgatgtgtcaaggcacatgaacacacttcagctgcagatggaagtgaccaggttcttgcatcggtgcgaaagtgctgggacctctcaaatcaccactttgcctctgccaaccctgtttggaaataaccacatgaaaatggatgttgcctgcaaggtcatgctgggagggaaaaatgtagaagatggttttggaattgctttccgtgttctgcaggacttccagctggatgctgccatgacctactgcagagctgcccgccagttggtggagaaagagaagtacagtgagatccagcaactgctcaaatgtgtcagtgagtcaggcatggcagccaaaagtgacggggacaccatcctcctcaactgcctggaagcgttcaagagaattccgccccaggagctggagggcctgatccaggcaatacacaatgatgacaacaaggtgagcggaattgtctccaaacgctggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - C-type lectin domain family 7, member A
- cytotoxic and regulatory T cell molecule
- melanocortin 2 receptor accessory protein
- OTU domain, ubiquitin aldehyde binding 2

Buy ZFYVE26-zinc finger, FYVE domain containing 26 Gene now

Add to cart