Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CLEC7A-C-type lectin domain family 7, member A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CLEC7A-C-type lectin domain family 7, member A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC071746 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CLEC7A |
| Origin species: | Human |
| Product name: | CLEC7A-C-type lectin domain family 7, member A Gene |
| Size: | 2ug |
| Accessions: | BC071746 |
| Gene id: | 64581 |
| Gene description: | C-type lectin domain family 7, member A |
| Synonyms: | BGR; CANDF4; CD369; CLECSF12; DECTIN1; SCARE2; C-type lectin domain family 7 member A; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12; C-type lectin superfamily member 12; DC-associated C-type lectin 1; beta-glucan receptor; dectin-1; dendritic cell-associated C-type lectin-1; lectin-like receptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaatatcatcctgatttagaaaatttggatgaagatggatatactcaattacacttcgactctcaaagcaataccaggatagctgttgtttcagagaaaggatcgtgtgctgcatctcctccttggcgcctcattgctgtaattttgggaatcctatgcttggtaatactggtgatagctgtggtcctgggtaccatgggggttctttccagcccttgtcctcctaattggattatatatgagaagagctgttatctattcagcatgtcactaaattcctgggatggaagtaaaagacaatgctggcaactgggctctaatctcctaaagatagacagctcaaatgaattggtaagtgtagacttctgttatgattatctgtggtgtgtatcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytotoxic and regulatory T cell molecule - melanocortin 2 receptor accessory protein - OTU domain, ubiquitin aldehyde binding 2 - coiled-coil and C2 domain containing 1B |