MMP13-matrix metallopeptidase 13 (collagenase 3) Gene View larger

MMP13-matrix metallopeptidase 13 (collagenase 3) Gene

PTXBC067522

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MMP13-matrix metallopeptidase 13 (collagenase 3) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MMP13-matrix metallopeptidase 13 (collagenase 3) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC067522
Product type: DNA & cDNA
Ncbi symbol: MMP13
Origin species: Human
Product name: MMP13-matrix metallopeptidase 13 (collagenase 3) Gene
Size: 2ug
Accessions: BC067522
Gene id: 4322
Gene description: matrix metallopeptidase 13 (collagenase 3)
Synonyms: CLG3; MANDP1; MDST; MMP-13; collagenase 3; matrix metalloproteinase 13 (collagenase 3); matrix metallopeptidase 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatccaggggtcctggctgccttcctcttcttgagctggactcattgtcgggccctgccccttcccagtggtggtgatgaagatgatttgtctgaggaagacctccagtttgcagagcgctacctgagatcatactaccatcctacaaatctcgcgggaatcctgaaggagaatgcagcaagctccatgactgagaggctccgagaaatgcagtctttcttcggcttagaggtgactggcaaacttgacgataacaccttagatgtcatgaaaaagccaagatgcggggttcctgatgtgggtgaatacaatgttttccctcgaactcttaaatggtccaaaatgaatttaacctacagaattgtgaattacacccctgatatgactcattctgaagtcgaaaaggcattcaaaaaagccttcaaagtttggtccgatgtaactcctctgaattttaccagacttcacgatggcattgctgacatcatgatctcttttggaattaaggagcatggcgacttctacccatttgatgggccctctggcctgctggctcatgcttttcctcctgggccaaattatggaggagatgcccattttgatgatgatgaaacctggacaagtagttccaaaggctacaacttgtttcttgttgctgcgcatgagttcggccactccttaggtcttgaccactccaaggaccctggagcactcatgtttcctatctacacctacaccggcaaaagccactttatgcttcctgatgacgatgtacaagggatccagtctctctatggtccaggagatgaagaccccaaccctaaacatccaaaaacgccagacaaatgtgacccttccttatcccttgatgccattaccagtctccgaggagaaacaatgatctttaaagacagattcttctggcgcctgcatcctcagcaggttgatgcggagctgtttttaacgaaatcattttggccagaacttcccaaccgtattgatgctgcatatgagcacccttctcatgacctcatcttcatcttcagaggtagaaaattttgggctcttaatggttatgacattctggaaggttatcccaaaaaaatatctgaactgggtcttccaaaagaagttaagaagataagtgcagctgttcactttgaggatacaggcaagactctcctgttctcaggaaaccaggtctggagatatgatgatactaaccatattatggataaagactatccgagactaatagaagaagacttcccaggaattggtgataaagtagatgctgtctatgagaaaaatggttatatctattttttcaacggacccatacagtttgaatacagcatctggagtaaccgtattgttcgcgtcatgccagcaaattccattttgtggtgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - trafficking protein particle complex 10
- CUG triplet repeat, RNA binding protein 2
- WNT1 inducible signaling pathway protein 2
- nucleolar protein family 6 (RNA-associated)

Buy MMP13-matrix metallopeptidase 13 (collagenase 3) Gene now

Add to cart