TRAPPC10-trafficking protein particle complex 10 Gene View larger

TRAPPC10-trafficking protein particle complex 10 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRAPPC10-trafficking protein particle complex 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRAPPC10-trafficking protein particle complex 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC046241
Product type: DNA & cDNA
Ncbi symbol: TRAPPC10
Origin species: Human
Product name: TRAPPC10-trafficking protein particle complex 10 Gene
Size: 2ug
Accessions: BC046241
Gene id: 7109
Gene description: trafficking protein particle complex 10
Synonyms: EHOC-1; EHOC1; GT334; TMEM1; TRS130; TRS30; trafficking protein particle complex subunit 10; TRAPP 130 kDa subunit; TRAPP subunit TMEM1; epilepsy holoprosencephaly candidate-1 protein; trafficking protein particle complex subunit 130; trafficking protein particle complex subunit TMEM1; transmembrane protein 1; transport protein particle subunit TMEM1; trafficking protein particle complex 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgcctctgaggagccgctgccgccggtgatctacaccatggagaacaagcccatcgtcacctgtgctggagatcagaatttatttacctctgtttatccaacgctctctcagcagcttccaagagaaccaatggaatggagaaggtcctatggccgggctccgaagatgattcacctagagtctaactttgttcaattcaaagaggagctgctgcccaaagaaggaaacaaagctctgctcacgtttcccttcctccatatttactggacagagtgctgtgataccgaagtgtataaagctacagtaaaagatgacctcaccaagtggcagaatgttctgaaggctcatagctctgtggactggttaatagtgatagttgaaaatgatgccaagaaaaaaaacaaaaccaacatccttccccgaacctctattgtggacaaaataagaaatgatttttgtaataaacagagtgacaggtgtgttgtgctctccgaccccttgaaggactcttctcgaactcaggaatcctggaatgccttcctgaccaaactcaggacattgcttcttatgtcttttaccaaaaacctaggcaagtttgaggatgacatgagaaccttgagggagaagaggactgagccaggctggagcttttgtgaatatttcatggttcaggaggagcttgcctttgttttcgagatgctgcagcagttcgaggacgccctggtgcagtacgacgaactggacgccctcttctctcagtatgtggtcaacttcggggccgggggtataaaatgtcctttccacaactcagtggcctgctggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CUG triplet repeat, RNA binding protein 2
- WNT1 inducible signaling pathway protein 2
- nucleolar protein family 6 (RNA-associated)
- lectin, galactoside-binding, soluble, 9C

Buy TRAPPC10-trafficking protein particle complex 10 Gene now

Add to cart