PTXBC058074
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC058074 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WISP2 |
| Origin species: | Human |
| Product name: | WISP2-WNT1 inducible signaling pathway protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC058074 |
| Gene id: | 8839 |
| Gene description: | WNT1 inducible signaling pathway protein 2 |
| Synonyms: | CCN5; CT58; CTGF-L; WNT1-inducible-signaling pathway protein 2; CCN family member 5; connective tissue growth factor-like protein; connective tissue growth factor-related protein 58; WNT1 inducible signaling pathway protein 2 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagaggcacaccgaagacccacctcctggccttctccctcctctgcctcctctcaaaggtgcgtacccagctgtgcccgacaccatgtacctgcccctggccacctccccgatgcccgctgggagtacccctggtgctggatggctgtggctgctgccgggtatgtgcacggcggctgggggagccctgcgaccaactccacgtctgcgacgccagccagggcctggtctgccagcccggggcaggacccggtggacggggggccctgtgcctctgtaagcaggaccccagttttctggccttgtctcttccctgccccctggtgtcccctgcccagaatggagcacggcctggggaccctgctcgaccacctgtgggctgggcatggccacccgggtgtccaaccagaaccgcttctgccgactggagacccagcgccgcctgtgcctgtccaggccctgcccaccctccaggggtcgcagtccacaaaacagtgccttctagagccgggctgggaatggggacacggtgtccaccatccccagctggtggccctgtgcctgggccctgggctgatggaagatggtccgtgcccaggcccttggctgcaggcaacactttagcttgggtccaccatgcagaacaccaatattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - nucleolar protein family 6 (RNA-associated) - lectin, galactoside-binding, soluble, 9C - phosphodiesterase 4D interacting protein - zinc finger, CCCH-type with G patch domain |