SRD5A2L2-steroid 5 alpha-reductase 2-like 2 Gene View larger

SRD5A2L2-steroid 5 alpha-reductase 2-like 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SRD5A2L2-steroid 5 alpha-reductase 2-like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SRD5A2L2-steroid 5 alpha-reductase 2-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC072463
Product type: DNA & cDNA
Ncbi symbol: SRD5A2L2
Origin species: Human
Product name: SRD5A2L2-steroid 5 alpha-reductase 2-like 2 Gene
Size: 2ug
Accessions: BC072463
Gene id: 253017
Gene description: steroid 5 alpha-reductase 2-like 2
Synonyms: SRD5A2L2; GPSN2L; TERL; trans-2,3-enoyl-CoA reductase-like; glycoprotein, synaptic 2-like; steroid 5 alpha-reductase 2-like 2; steroid 5-alpha-reductase 2-like 2 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcaaaaggcacaagtccctcgcttcggaacgcaagagagcattactttcccaaagagctacacggttcatactgaaggatgatatgagaaattttcactttttgtcaaaacttgtactctcagcgggccctctaagaccaactccagcagtcaaacattcaaagacgactcactttgagattgaaatatttgatgctcaaacaaggaaacagatatgtattctggataaggtgacacaatcatctactattcatgatgttaagcaaaagtttcacaaagcatgtccaaagtggtacccttctcgagttggtctgcagctagaatgtggcgggccttttttgaaggactacattaccattcaaagtattgcagcttcctccattgtcacactgtatgctacagacctaggtcaacaagtcagttggaccacagtgtttttggctgaatacacaggacctctgctaatatacctcctcttttatttgaggatcccatgtatatatgatggaaaagagagtgctagaagattacgccacccagtggtacacttggcttgcttctgtcattgtatacactacatccgataccttttggaaaccttatttgttcacaaagtttctgcaggacacacacctttgaaaaatttgataatgagttgtgccttttactggggatttacttcttggattgcctactacattaatcatccactatatacaccaccatgtatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 102B
- trophinin associated protein (tastin)
- beta-1,4-mannosyltransferase-like
- CD3d molecule, delta (CD3-TCR complex)

Buy SRD5A2L2-steroid 5 alpha-reductase 2-like 2 Gene now

Add to cart