TROAP-trophinin associated protein (tastin) Gene View larger

TROAP-trophinin associated protein (tastin) Gene

PTXBC011597

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TROAP-trophinin associated protein (tastin) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TROAP-trophinin associated protein (tastin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011597
Product type: DNA & cDNA
Ncbi symbol: TROAP
Origin species: Human
Product name: TROAP-trophinin associated protein (tastin) Gene
Size: 2ug
Accessions: BC011597
Gene id: 10024
Gene description: trophinin associated protein (tastin)
Synonyms: TASTIN; trophinin assisting protein; trophinin-assisting protein (tastin); trophinin associated protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccacccggcaagccacgaaggatcccctcctccggggtgtatctcctacccctagcaagattccggtacgctctcagaaacgcacgcctttccccactgttacatcgtgcgccgtggaccaggagaaccaagatccaaggagatgggtgcagaaaccaccgctcaatattcaacgccccctcgttgattcagcaggccccaggccgaaagccaggcaccaggcagagacatcacaaagattggtggggatcagtcagcctcggaaccccttggaagagctcaggcctagccctaggggtcaaaatgtggggcctgggccccctgcccagacagtcctggtcccagctcctggaaagctctttgctcttagaagatctccctttcctccagcaaaatgtcatctcgccaggtgccatggcttgtacctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - beta-1,4-mannosyltransferase-like
- CD3d molecule, delta (CD3-TCR complex)
- thyroid hormone receptor interactor 4
- KN motif and ankyrin repeat domains 2

Buy TROAP-trophinin associated protein (tastin) Gene now

Add to cart