Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TROAP-trophinin associated protein (tastin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TROAP-trophinin associated protein (tastin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011597 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TROAP |
| Origin species: | Human |
| Product name: | TROAP-trophinin associated protein (tastin) Gene |
| Size: | 2ug |
| Accessions: | BC011597 |
| Gene id: | 10024 |
| Gene description: | trophinin associated protein (tastin) |
| Synonyms: | TASTIN; trophinin assisting protein; trophinin-assisting protein (tastin); trophinin associated protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccacccggcaagccacgaaggatcccctcctccggggtgtatctcctacccctagcaagattccggtacgctctcagaaacgcacgcctttccccactgttacatcgtgcgccgtggaccaggagaaccaagatccaaggagatgggtgcagaaaccaccgctcaatattcaacgccccctcgttgattcagcaggccccaggccgaaagccaggcaccaggcagagacatcacaaagattggtggggatcagtcagcctcggaaccccttggaagagctcaggcctagccctaggggtcaaaatgtggggcctgggccccctgcccagacagtcctggtcccagctcctggaaagctctttgctcttagaagatctccctttcctccagcaaaatgtcatctcgccaggtgccatggcttgtacctgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - beta-1,4-mannosyltransferase-like - CD3d molecule, delta (CD3-TCR complex) - thyroid hormone receptor interactor 4 - KN motif and ankyrin repeat domains 2 |