CCDC102B-coiled-coil domain containing 102B Gene View larger

CCDC102B-coiled-coil domain containing 102B Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC102B-coiled-coil domain containing 102B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC102B-coiled-coil domain containing 102B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC056269
Product type: DNA & cDNA
Ncbi symbol: CCDC102B
Origin species: Human
Product name: CCDC102B-coiled-coil domain containing 102B Gene
Size: 2ug
Accessions: BC056269
Gene id: 79839
Gene description: coiled-coil domain containing 102B
Synonyms: ACY1L; C18orf14; HsT1731; coiled-coil domain-containing protein 102B; coiled-coil domain containing 102B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaggaaagagaaatgcgcacagctttggaaaaagaaatagagagactggagtcggctttgtctctgtggaagtggagtttgacattcttcttggtcaacataatgatgaaatgcaagaactgtcaggcaatataaaggaagaatccaaatctcaaaacagcaaagacagagtgatttgtgagttaagagcagagctagagagattgcaagctgaaaatacctcggagtgggacaagagggaaatacttgaaagagaaaagcagggactggagagagaaaatagaaggctgaagatccaggtgaaagaaatggaagagcttttggataagaaaaatagattaagtgcaaactctcaaagtcctgatttcaagatgtcacaaattgatctgcaagaaaaaaaccaggatgtaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - trophinin associated protein (tastin)
- beta-1,4-mannosyltransferase-like
- CD3d molecule, delta (CD3-TCR complex)
- thyroid hormone receptor interactor 4

Buy CCDC102B-coiled-coil domain containing 102B Gene now

Add to cart