Login to display prices
Login to display prices
CCDC102B-coiled-coil domain containing 102B Gene View larger

CCDC102B-coiled-coil domain containing 102B Gene

PTXBC056269

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC102B-coiled-coil domain containing 102B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC102B-coiled-coil domain containing 102B Gene

Proteogenix catalog: PTXBC056269
Ncbi symbol: CCDC102B
Product name: CCDC102B-coiled-coil domain containing 102B Gene
Size: 2ug
Accessions: BC056269
Gene id: 79839
Gene description: coiled-coil domain containing 102B
Synonyms: ACY1L; C18orf14; HsT1731; coiled-coil domain-containing protein 102B; coiled-coil domain containing 102B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaggaaagagaaatgcgcacagctttggaaaaagaaatagagagactggagtcggctttgtctctgtggaagtggagtttgacattcttcttggtcaacataatgatgaaatgcaagaactgtcaggcaatataaaggaagaatccaaatctcaaaacagcaaagacagagtgatttgtgagttaagagcagagctagagagattgcaagctgaaaatacctcggagtgggacaagagggaaatacttgaaagagaaaagcagggactggagagagaaaatagaaggctgaagatccaggtgaaagaaatggaagagcttttggataagaaaaatagattaagtgcaaactctcaaagtcctgatttcaagatgtcacaaattgatctgcaagaaaaaaaccaggatgtaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: