Login to display prices
Login to display prices
GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene View larger

GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene

PTXBC010157

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene

Proteogenix catalog: PTXBC010157
Ncbi symbol: GPX4
Product name: GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene
Size: 2ug
Accessions: BC010157
Gene id: 2879
Gene description: glutathione peroxidase 4 (phospholipid hydroperoxidase)
Synonyms: GPx-4; GSHPx-4; MCSP; PHGPx; SMDS; snGPx; snPHGPx; phospholipid hydroperoxide glutathione peroxidase, mitochondrial; phospholipid hydroperoxide glutathione peroxidase; phospholipid hydroperoxidase; sperm nucleus glutathione peroxidase; glutathione peroxidase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcagcaagatctgcgtgaacggggacgacgcccacccgctgtggaagtggatgaagatccaacccaagggcaagggcatcctgggaaatgccatcaagtggaacttcaccaagttcctcatcgacaagaacggctgcgtggtgaagcgctacggacccatggaggagcccctggtgatagagaaggacctgccccactatttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: