Cart 2 Product Products 234,90 € (empty)
-
1 x HLA-DRA-ma...113,40 € -
1 x TFDP3-tran...121,50 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
View larger 
GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene
PTXBC010157
New product
Data sheet of GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010157 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPX4 |
| Origin species: | Human |
| Product name: | GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene |
| Size: | 2ug |
| Accessions: | BC010157 |
| Gene id: | 2879 |
| Gene description: | glutathione peroxidase 4 (phospholipid hydroperoxidase) |
| Synonyms: | GPx-4; GSHPx-4; MCSP; PHGPx; SMDS; snGPx; snPHGPx; phospholipid hydroperoxide glutathione peroxidase, mitochondrial; phospholipid hydroperoxide glutathione peroxidase; phospholipid hydroperoxidase; sperm nucleus glutathione peroxidase; glutathione peroxidase 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcagcaagatctgcgtgaacggggacgacgcccacccgctgtggaagtggatgaagatccaacccaagggcaagggcatcctgggaaatgccatcaagtggaacttcaccaagttcctcatcgacaagaacggctgcgtggtgaagcgctacggacccatggaggagcccctggtgatagagaaggacctgccccactatttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 3, subfamily A, polypeptide 7 - nucleolar complex associated 4 homolog (S. cerevisiae) - nascent polypeptide-associated complex alpha subunit 2 - 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 |